User:Rdf15c/sandbox

Guide RNAs (a.k.a. gRNA, sgRNA) are the RNAs that guide the insertion or deletion of uridine residues into mitochondrial mRNAs in kinetoplastid protists in a process known as RNA editing.

The terms "guide RNA" and "gRNA" are also used in prokaryotic DNA editing involving CRISPR and Cas9. The gRNA is responsible for the specificity of the CRISPR-Cas9 system. These are non coding short RNA sequence which binds to the complementary target DNA sequences. Guide RNA first bind to Cas9 enzyme and gRNA sequence guides the complex to get paired at the specific location on DNA, where Cas9 performs its endonuclease activity and cut the target DNA strand.

In addition to expression of the Cas9 nuclease, the CRISPR-Cas9 system requires a specific RNA molecule to recruit and direct the nuclease activity to the region of interest. These guide RNAs take one of two forms:

1. A synthetic trans-activating CRISPR RNA (tracrRNA) plus a sythetic CRISPR RNA (crRNA) designed to cleave the gene target site of interest
2. A synthetic or expressed single guide RNA (sgRNA) that consists of both the crRNA and tracrRNA as a single construct

The CRISPR RNA (crRNA and the trans-activating CRISPR RNA (tracrRNA) form a complex which acts as the guide RNA for the Cas9 enzyme. The scaffolding ability of tracrRNA along with crRNA specificity can be combined into a single synthetic gRNA which simplifies guiding of gene alterations to a one component system which may increase efficiencies.

(TOC)

History

Guide RNA are discovered in 1990 by Blum B1, Bakalara N, Simpson because of their participation in RNA editing in the mitochondrion of Leishmania tarentolae. These gRNA molecules are encoded in maxicircle DNA in mitochondria having sequences that are complementary to mature mRNAs within the edited regions. They performed multiple events for cleaving, inserting and deleting uridylates after the formation of partial hybrid between gRNA and pre-edited mRNA

Guide RNA in Protists

Trypanosomatid protists and other kinetoplastids have a novel post-transcriptional mitochondrial RNA modification process known as "RNA editing". They have large segment of highly organized DNA segments present in mitochondria. This mitochondrial DNA is circular in form and can be classified in two categories, maxicircles and minicircles. There are 20-50 maxicircles per cells having both coding and non coding regions. The coding region is highly conserved (16-17kb) and non coding region varies depending on the species. Mini circles are lesser in size () but more in number as compared to maxicircles. Minicircles constitute 95% of mass of kinetoplastid DNA. Maxicircles that encode genes and "cryptogenes" (and some gRNAs) and minicircles are responsible for encoding majoity of gRNAs. It has been observed that 1000 gRNA can be encoded by 250 or more minicircles. Some gRNAs genes shows identical insertion and deletion sites even if they have different sequences. However, some gRNA sequences are not complementary to pre edited mRNA. Maxicircles and minicircles molecules are catenated into a giant network of DNA that is situated at the base of the flagellum in the inner compartment of the single mitochondrion.

A majority of the maxicircle transcripts can not be translated into proteins due to multiple frameshifts in the sequences. These frameshifts are corrected after transcription by the insertion and deletion of uridine residues at precise sites which create an open reading frame that is translated into a mitochondrial protein homologous to mitochondrial proteins from other cells. The insertions and deletions are mediated by short guide RNA (gRNAs) which encode the editing information in the form of complementary sequences (allowing GU as well as GC base pairs).

gRNA-mRNA Complex

The guide RNA are mainly transcribed from the intergenic region of DNA maxicircle and these are complementary to mature mRNA. It is important for gRNA to interact initially with pre-edited mRNA and then its 5' region base pair with complementary mRNA . The 3' end of gRNA contains oligo 'U' tail (5-25 nucleotides in length) which is a non encoded region but interacts and forms a stable complex with A and G rich region of mRNA. This initial hybrid helps in the recognition of specific mRNA site to be edited.

Function

The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of ribonucleoprotein complexes that direct the cleavage of first mismatched base adjacent to gRNA-mRNA anchor. Uridyly transferase inserts 'U' at 3' terminal and RNA ligase is responsible for joining of two cut ends. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of modification is termed as original enzyme cascade model

In the case of "pan-edited" mRNAs, the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A retroposition model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.

It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondrion of the ancestor of the kintoplastid protist lineage, since it is present in the bodonids which are ancestral to the trypanosomatids, and may not be present in the euglenoids, which branched from the same common ancestor as the kinetoplastids.

In the protozoan Leishmania tarentolae, 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:

mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific endonucleases cleaves the mRNA at the mismatch site.

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5'   A  A   AGAAA   A G  G C UUUAACUUCAGGUUGU 3'

The mRNA is now "repaired" by adding U's at each editing site in succession, giving the following sequence:

gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA)

Guide RNA in Prokaryotes

CRISPR In Prokayotes

Most of the prokaryotes like bacteria and archea makes the use of their adaptive immune system using CRISPR (clustered regularly interspaced short palindromic repeats) and cas enzyme to detect and remove the foreign genetic material. When prokaryotes are infected by bacteriophages , then the phage DNA give rise to short cluster repeats (CRISPR) which are used to detect and cleave the DNA fragments from similar type of phages. This defense mechanism of prokaryotes is used as editing technique which can used in gene therapy process as well. The CRISPR Cas editing method makes the use gRNA for identification and cleavage of DNA strands.

Structure

Guide RNA targets the complimentary sequences by simple Watson and crick base pairing. In type II CRISPR/cas system , single guide RNA directs the target specific regions. Single guide RNA are artificially programmed combination of two RNA molecules, one component (tracrRNA) is responsible for Cas9 endonuclease activity and other (crRNA) binds to the target specific DNA region. Therefore, the trans activating RNA (tracrRNA) and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA. TracrRNA are base pairs having a stemloop structure in itself and attaches to the endonuclease enzyme. Transcription of CRISPR locus gives CRISPR RNA (crRNA) which have spacer flanked region due to repeat sequences, consisting of 18-20 base pair. crRNA identifies the specific complementary target region which is cleaved by Cas9 after its binding with crRNA and tcRNA , which all together known as effector complex. With the modifications in the crRNA sequences of the guide RNA, the binding location can be changed and hence defining it as a user defined program.

Applications

Designing gRNAs

The targeting specificity of CRISPR-Cas9 is determined by the 20-nt sequence at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif (PAM) which is a short DNA sequence usually 2-6 base pairs in length that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site. After base pairing of the gRNA to the target, Cas9 mediates a double strand break about 3-nt upstream of PAM.

The GC content of the guide sequence should be 40-80%. High GC content stabilizes the RNA-DNA duplex while destabilizing off-target hybridization. The length of the guide sequence should be between 17-24bp noting a shorter sequence minimizes off-target effects. Guide sequences less that 17bp have a chance of targeting multiple loci.

CRISPR Cas9

CRISPR ( Clustered regularly interspaced short palindromic repeats)/Cas9 is one of an important technique for gene editing used in gene therapy. Cas is an endonuclease enzyme that cuts the DNA at a specific location directed by guide RNA. This is a target specific technique that can introduce gene knock out or knock depending on the double strand repair pathway. Evidences shows that both invito and invivo required tracrRNA is for Cas9 and target DNA sequence binding. Three main stages constitute CRISPER CAS9 system. first stage is extension of bases in the CRISPR locus region by addition of foriegn DNA spacers in the genome sequence. Several different protein like cas1 and cas2 are help in finding new spacers. Next stage is transcription of CRISPER , pre-crRNA (precursor CRISPER RNA) are expressed by the transcription of CRISPR repeat- spacer array. On futher modification in the pre-crRNA are converted to single spacer flanked region forming short crRNA. RNA maturation process is similar in type I and II but different in type III, aRNA as tracr are added in this step. Third stage involves binding of cas9 protein and directing it to cleave the DNA segment. Cas9 protein binds to combined form of crRNA and tracrRNA forming an effector complex. This act as guide RNA for cas9 protein directing it for its endonuclease activity

RNA Mutagenesis

One of an important gene regulation method is RNA mutagenesis which can be introduced by RNA editing with the help of gRNA. Guide RNA replaces adenosine with inosine at the specific target site and modify the genetic code. Adenosine deaminase acts on RNA bringing post transcriptional modification by altering the codons and different protein functions. Guide RNAs are the small nucleloar RNA, these along with riboproteins perform intracellular RNA alterations such as ribomethylation in rRNA and introduction of pseudouridine in preribosomal RNA. Guide RNAs binds to the anti sense RNA sequence and regulates the RNA modification. It is observed that small interfering RNA (siRNA) and micro RNA (miRNA) are generally used as target RNA sequence and modifications are comparatively easy to introduce because of small size.

See also

• CRISPR gene editing
• CRISPR/Cas Tools
• SiRNA
• Gene knockout
• Protospacer adjacent motif

References

Guide RNA-directed uridine insertion RNA editing in vitrohttp://www.jbc.org/content/272/7/4212.full

Guide RNAs in kinetoplastid mitochondria have a nonencoded 3′ oligo(U) tail involved in recognition of the preedited region https://doi.org/10.1016/0092-8674(90)90375-O

A model for RNA editing in kinetoplastid mitochondria: RNA molecules transcribed from maxicircle DNA provide the edited informationBlum B1, Bakalara N, Simpson L https://doi.org/10.1016/0092-8674(90)90735-W

RNA editing in kinetoplastids, Stephen Hajduk & Torsten Ochsenreiter https://doi.org/10.4161/rna.7.2.11393

Complete set of mitochondrial pan-edited mRNAs in Leishmania mexicana amazonensis LV78, Dmitri A. Maslov https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2913609/

1.Highly multiplexed genome engineering using CRISPR/Cas9 gRNA arrays 10.1371/journal.pone.0198714
2.GUIDES: sgRNA design for loss-of-function screens Joshua A. Meier, Feng Zhang, and Neville E. Sanjana

3.Construction of a guide-RNA for site-directed RNA mutagenesis utilising intracellular A-to-I RNA editing Masatora Fukuda, Hiromitsu Umeno, Kanako Nose,Azusa Nishitarumizu,Ryoma Noguchi, and Hiroyuki Nakagawa

4. Multiplexed CRISPER/Cas9 gene knockout with simple crRNA:tracrRNA co-transfection Fehand J. Khan, Garmen Yuen and Ji Luo

5. Structure and mechanism of CRISPR RNA -guided effector nucleases Hiroshi Nishimasu Osamu https://doi.org/10.1016/j.sbi.2016.11.013

6 DeepCRISPR: optimized CRISPR guide RNA design by deep learning https://doi.org/10.1186/s13059-018-1459-4